After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat KLRC1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat KLRC1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001037441.1
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Rattus norvegicus killer cell lectin-like receptor subfamily C, member 1 with N terminal His tag.
Gene Synonym:rNKG2A, Klrc1
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

NKG2, also known as NKG2A(CD159A), is a member of the killer cell lectin-like receptor family. This family is a group of transmembrane proteins preferentially expressed in NK cells. Members of this fmaily are characterized by the type II membrane orientation and the presence of a C-type lectin domain. NKG2 contains 1 C-type lectin domain and forms a complex with another family member, KLRD1/CD94. It is expressed only in NK-cells, but not in T-cells or B-cells. It has been shown that NKG2 represents a family of related cDNA clones, designated NKG2A, NKG2B, NKG2C, and NKG2D, which encode type 2 integral membrane proteins (extracellular C-terminus) containing a C-type lectin domain. Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NKG2 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells.

References
  • Angelini DF, et al. (2011) NKG2A inhibits NKG2C effector functions of gamma delta T cells: implications in health and disease. J Leukoc Biol. 89(1):75-84.
  • Ge SJ, et al. (2011) Expression of NKG2D and NKG2A with their ligands MHC-I A/B and HLA-E in acute leukemia patients and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 19(2):312-6.
  • Ablamunits V, et al. (2011) NKG2A is a marker for acquisition of regulatory function by human CD8+ T cells activated with anti-CD3 antibody. Eur J Immunol. 41(7):1832-42.
  • Size / Price
    Catalog: RG80370-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"