Quick Order

Text Size:AAA

Rat TGM2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat TGM2 cDNA Clone Product Information
Gene_bank_ref_id:NM_019386.2
RefSeq ORF Size:2061bp
cDNA Description:Full length Clone DNA of Rattus norvegicus transglutaminase 2, C polypeptide with N terminal HA tag.
Gene Synonym:TgaseII
Species:Rat
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Protein-glutamine gamma-glutamyltransferase 2, also known as Tissue transglutaminase, Transglutaminase C, Transglutaminase-2, and TGM2, is a member of the transglutaminase superfamily. TGM2 plays a role in cell growth and survival through the anti-apoptosis signaling pathway. It is a calcium-dependent acyltransferase which also undergoes a GTP-binding/GTPase cycle even though it lacks any obvious sequence similarity with canonical GTP-binding (G) proteins. TGM2 is a multi-functional protein which catalyzes transamidation reactions or acts as a G-protein in intracellular signalling. As an enzyme which is responsible for the majority of transglutaminase (TG) activity in the brain, TGM2 is likely to play a modulatory role in nervous system development and has regulatory effect on neuronal cell death as well. Most importantly, numerous studies have presented data demonstrating that dysregulation of TGM2 may contribute to the pathogenesis of many neurodegenerative disorders, including Huntington's disease, Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis as well as nervous system injuries.

References
  • Ruan Q, et al. (2007) Transglutaminase 2 in neurodegenerative disorders. Front Biosci. 12: 891-904.
  • Ai L, et al. (2008) The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer. Carcinogenesis. 29(3): 510-8.
  • Filiano AJ, et al. (2010) Transglutaminase 2 protects against ischemic stroke. Neurobiol Dis. 39(3): 334-43.
  • Park D, et al. (2010) Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino Acids. 39(3): 619-31.
  • Miyoshi N, et al. (2010) TGM2 is a novel marker for prognosis and therapeutic target in colorectal cancer. Ann Surg Oncol. 17(4): 967-72.
  • Size / Price
    Catalog: RG80519-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"