Quick Order

Rat IL12B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL12BcDNA Clone Product Information
Gene_bank_ref_id:NM_022611.1
cDNA Size:1008
cDNA Description:ORF Clone of Rattus norvegicus interleukin 12b DNA.
Gene Synonym:Il12, Il12b
Species:Rat
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-12 Family & Receptor Related Products
Product nameProduct name
Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12B / P40 Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL27 / Interleukin-27 Protein (His Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12RB1 / IL12RB / CD212 Protein (His Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL12B / IL-12B Protein (Fc Tag)Mouse IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinCynomolgus / Rhesus IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL27 / Interleukin-27 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Cynomolgus / Rhesus IL12A / NKSF1 Protein (Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag) Cynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Marmoset IL12B / IL-12B Protein (Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL12A & IL27B Heterodimer Protein
Background

Subunit beta of interleukin 12 (also known as natural killer cell stimulatory factor 2, or cytotoxic lymphocyte maturation factor 2, p40) (IL12B) is a subunit of human interleukin 12. IL12B/IL-12B is a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. IL12B/IL-12B is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. IL12B/IL-12B associates with IL23A to form the IL-23 interleukin, an heterodimeric cytokine which functions in innate and adaptive immunity.

References
  • Taoufik Y, et al. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89 (8): 2842-8.
  • Fantuzzi L, et al. (1996) Induction of interleukin-12 (IL-12) by recombinant glycoprotein gp120 of human immunodeficiency virus type 1 in human monocytes/macrophages: requirement of gamma interferon for IL-12 secretion. J Virol. 70 (6): 4121-4.
  • Aragane Y, et al. (1995) IL-12 is expressed and released by human keratinocytes and epidermoid carcinoma cell lines. J Immunol. 153 (12): 5366-72.
  • Size / Price
    Catalog:RG80352-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"