Quick Order

Text Size:AAA

Rat SLC3A2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat SLC3A2 cDNA Clone Product Information
Gene_bank_ref_id:NM_019283.1
RefSeq ORF Size:1584bp
cDNA Description:Full length Clone DNA of Rattus norvegicus solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 with N terminal His tag.
Gene Synonym:Mdu1, Slc3a2
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-ratSLC3A2
Restriction Site:HindIII + XbaI (6kb + 1.67kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 804G/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.

References
  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.
  • Size / Price
    Catalog: RG80339-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"