Quick Order

Rat CLEC14A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC14AcDNA Clone Product Information
cDNA Size:1407
cDNA Description:ORF Clone of Rattus norvegicus C-type lectin domain family 14, member A DNA.
Gene Synonym:RGD1306232, Clec14a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

C-type lectin domain family 14 member A, also known as Epidermal growth factor receptor 5 and CLEC14A, is a member of the C-type lectin domain (CTLD) family that contains one c-type lectin domain and one EGF-like domain. Mouse CLEC14A is a 459 amino acid single-pass type I membrane protein. The superfamily of proteins containing C-type lectin-like domains (CTLDs) is a large group of extracellular Metazoan proteins with diverse functions. The CTLD structure has a characteristic double-loop ('loop-in-a-loop') stabilized by two highly conserved disulfide bridges located at the bases of the loops, as well as a set of conserved hydrophobic and polar interactions. Members of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp families were essentially formed early in vertebrate evolution and are completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates.

  • Ebner S, et al. (2003) Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1): 44-55.
  • Zelensky AN, et al. (2005) The C-type lectin-like domain superfamily. Gready JE. FEBS J. 272(24): 6179-217.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks