After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CD93 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD93cDNA Clone Product Information
cDNA Size:1932
cDNA Description:ORF Clone of Rattus norvegicus CD93 molecule DNA.
Gene Synonym:Ly68, C1qRp, C1qr1, Cd93
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system is selectively expressed on cells of the myeloid lineage. CD93/C1qR is a highly glycosylated transmembrane protein expressed on monocytes, neutrophils, endothelial cells, and stem cells. CD93 was originally identified as a myeloid cell-surface marker and subsequently associated with an ability to modulate phagocytosis of suboptimally opsonized immunoglobulin G and complement particles in vitro. CD93/C1qR, a receptor expressed during early B-cell development, is reinduced during plasma-cell differentiation. High CD93/CD138 expression was restricted to antibody-secreting cells both in T-dependent and T-independent responses as naive, memory, and germinal-center B cells remained CD93-negative. CD93 was expressed on (pre)plasmablasts/plasma cells, including long-lived plasma cells that showed decreased cell cycle activity, high levels of isotype-switched Ig secretion, and modification of the transcriptional network. CD93 is important for the maintenance of plasma cells in bone marrow niches.

  • Bohlson SS, et al. (2005) CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol. 175(2): 1239-47.
  • Norsworthy PJ, et al. (2004) Murine CD93 (C1qRp) contributes to the removal of apoptotic cells in vivo but is not required for C1q-mediated enhancement of phagocytosis. J Immunol. 172(6): 3406-14.
  • Chevrier S, et al. (2009) CD93 is required for maintenance of antibody secretion and persistence of plasma cells in the bone marrow niche. Proc Natl Acad Sci U S A. 106(10): 3895-900.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items