Quick Order

Rat CCL27 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CCL27 cDNA Clone Product Information
Gene_bank_ref_id:NM_001108660.1
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 27 with C terminal HA tag.
Gene Synonym:Ccl27
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

CCL27, also known as CTACK, is a small cytokine belonging to the CC chemokine family. Members of this family are proteins characterized by two adjacent cysteines. CCL27 is chemotactic for skin-associated memory T lymphocytes. CCL27 may also play a role in mediating homing of lymphocytes to cutaneous sites. CCL27 plays a pivotal role in establishing the inflammatory infiltrate characteristic for common inflammatory skin diseases. Through binding to the chemokine receptor 10 (CCR10), CCL27 mediates inflammation by promoting lymphocyte migration into the skin.

References
  • Morales. et al., 1999, Proc Natl Acad Sci. 96: 14470-5.
  • Homey. et al., 2002, J Immunol. 164: 3465-70.
  • Ishikawa-Mochizuki. et al., 1999, FEBS Lett. 460: 544-8.
  • Size / Price
    Catalog: RG80085-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"