After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat APCS / SAP ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat APCS cDNA Clone Product Information
NCBI RefSeq:NM_017170.2
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Rattus norvegicus amyloid P component, serum with C terminal HA tag.
Gene Synonym:Sap, Apcs
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

References
  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
  • Size / Price
    Catalog: RG80061-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"