Quick Order

Text Size:AAA

Rat Neurexophilin-1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat NXPH1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012994.2
RefSeq ORF Size:816bp
cDNA Description:Full length Clone DNA of Rattus norvegicus neurexophilin 1 with C terminal HA tag.
Gene Synonym:MGC124635, Nxph1
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Neurexophilin-1, or NXPH1 is a secreted glycoprotein, which belongs to the Neurexophilin family. The Neurexophilin family contain at least four genes and resembles a neuropeptide, suggesting a function as an endogenous ligand for alpha-neurexins. The mammalian brains contain four genes for neurexophilins the products of which share a common structure composed of five domains: an N-terminal signal peptide, a variable N-terminal domain, a highly conserved central domain that is N-glycosylated, a short linker region, and a conserved C-terminal domain that is cysteine-rich. Neurexophilin-1 constitutes a secreted cysteine-rich glycoprotein, forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. Neurexophilins 1 and 3 but not 4 (neurexophilin 2 is not expressed in rodents) bind to a single individual LNS domain, the second overall LNS domain in all three alpha-neurexins.

References
  • Missler M, et al. (1998) Neurexophilin binding to alpha-neurexins. A single LNS domain functions as an independently folding ligand-binding unit. J Biol Chem. 273(52): 34716-23.
  • Missler M, et al. (1998) Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci. 18(10): 3630-8.
  • Petrenko AG, et al. (1996) Structure and evolution of neurexophilin. J Neurosci. 16(14): 4360-9.
  • Size / Price
    Catalog: RG80047-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"