Quick Order

Text Size:AAA

Rat CCL3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL3cDNA Clone Product Information
cDNA Size:279
cDNA Description:ORF Clone of Rattus norvegicus chemokine (C-C motif) ligand 3 DNA.
Gene Synonym:Scya3, MIP-1a, Ccl3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name

CCL3 is a cytokine belonging to the CC chemokine family. Chemokines are a family of structurally related leukocyte chemoattractant cytokines that play a central role during immunoregulatory and inflammation processes. All chemokines contain four conserved cysteines linked by disulfide bonds, and two major subfamilies, namely CXC and CC, are defined on the basis of the first two cysteines which are separated by one amino acid or are adjacent. CCL3 is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes.

  • Zhao RY, et al. (2005) Viral infections and cell cycle G2/M regulation. Cell Res. 15(3):143-9. Joseph AM, et al. (2005) Nef: "necessary and enforcing factor" in HIV infection. Curr HIV Res. 3(1):87-94. Muthumani K, et al. (2004) HIV-1 Vpr and anti-inflammatory activity. DNA Cell Biol. 23(4): 239-47.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items