Quick Order

Rat CXCL16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL16cDNA Clone Product Information
cDNA Size:744
cDNA Description:ORF Clone of Rattus norvegicus chemokine (C-X-C motif) ligand 16 DNA.
Gene Synonym:CXCL16
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name

C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I membrane protein which belongs to the intercrine alpha (chemokine CxC) family. CXCL16 exists in transmembrane and soluble forms. The transmembrane form acts as a scavenger receptor for oxidised LDL whereas the soluble form acts a chemoattractant for mainly CD8+ T cells. CXCL16 is a protein which shares pattern recognition receptor functions, relevant for adhesion and phagocytosis of bacterial products, with the properties of an adhesion molecule and inflammatory chemokine. CXCL16/SR-PSOX is an interferon-gamma-regulated chemokine and scavenger receptor for oxidized low-density lipoprotein that is expressed in atherosclerotic lesions. Proteolytic cleavage of membrane-bound CXCL16 releases soluble CXCL16, which may promote migration of effector T cells and augment a proatherogenic inflammatory response. CXCL16/SR-PSOX can be a potential player in atherogenesis. Enhanced expression of CXCL16 has been demonstrated in atherosclerotic plaques and several properties have been attributed to CXCL16 that could influence the atherosclerotic process. Following in vitro studies suggested that as an adhesion molecule CXCL16/SR-PSOX might mediate T-cell adhesion to the endothelium, as a chemokine-drive T-cell migration, stimulate cell proliferation and elicit inflammatory phenotype in smooth muscle cells (SMC) and, finally, as a scavenger receptor-mediate uptake of atherogenic lipoproteins by macrophages and SMC. CXCR6 and its ligand CXCL16 in regulating metastasis and invasion of cancer. CXCR6 and CXCL16 are up-regulated in multiple cancer tissue types and cancer cell lines relative to normal tissues and cell lines. In addition, both CXCR6 and CXCL16 levels increase as tumor malignancy increases. Thus, CXCL16 and CXCR6 may mark cancers arising in an inflammatory milieu and mediate pro-tumorigenic effects of inflammation through direct effects on cancer cell growth and by inducing the migration and proliferation of tumor-associated leukocytes.

  • Sheikine Y, et al. (2008) CXCL16/SR-PSOX--a friend or a foe in atherosclerosis? Atherosclerosis. 197(2): 487-95.
  • Lehrke M, et al. (2008) CXCL16 is a surrogate marker of inflammatory bowel disease. Scand J Gastroenterol. 43(3): 283-8.
  • Jansson AM, et al. (2009) Soluble CXCL16 predicts long-term mortality in acute coronary syndromes. Circulation. 119(25): 3181-8.
  • Darash-Yahana M, et al. (2009) The chemokine CXCL16 and its receptor, CXCR6, as markers and promoters of inflammation-associated cancers. PLoS One. 4(8): e6695.
  • Deng L, et al. (2010) CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer. Biochim Biophys Acta. 1806(1): 42-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items