Quick Order

Rat RBP4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat RBP4 cDNA Clone Product Information
NCBI RefSeq:NM_013162.1
RefSeq ORF Size:606bp
cDNA Description:Full length Clone DNA of Rattus norvegicus retinol binding protein 4, plasma with C terminal HA tag.
Gene Synonym:RBPA, Rbp4
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible for the conversion of unstable and insoluble retinol in aqueous solution into stable and soluble complex in plasma through their tight interaction. As a member of the lipocalin superfamily, RBP4 containing a β-barrel structure with a well-defined cavity is secreted from the liver, and in turn delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP4-retinol complex interacts with transthyretin (TTR), and this binding is crucial for preventing RBP4 excretion through the kidney glomeruli. RBP4 expressed from an ectopic source efficiently delivers retinol to the eyes, and its deficiency affects night vision largely. Recently, RBP4 as an adipokine, is found to be expressed in adipose tissue and correlated with obesity, insulin resistance (IR) and type 2 diabetes (T2DM).

References
  • Yang Q, et al. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature. 436(7049): 356-62.
  • Choi SH, et al. (2008) High plasma retinol binding protein-4 and low plasma adiponectin concentrations are associated with severity of glucose intolerance in women with previous gestational diabetes mellitus. J Clin Endocrinol Metab. 93(8): 3142-8.
  • Tepper BJ, et al. (2010) Serum retinol-binding protein 4 (RBP4) and retinol in a cohort of borderline obese women with and without gestational diabetes. Clin Biochem. 43(3): 320-3.
  • Size / Price
    Catalog: RG80008-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"