Quick Order

Text Size:AAA

Rat GpT2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat GPT2 cDNA Clone Product Information
NCBI RefSeq:NM_001012057.1
RefSeq ORF Size:1569bp
cDNA Description:Full length Clone DNA of Rattus norvegicus glutamic pyruvate transaminase (alanine aminotransferase) 2 with C terminal HA tag.
Gene Synonym:ALT2, Cc2-5, Gpt2
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (Gpt), is a pyridoxal enzyme which catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. Gpt1 is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level, whereas Gpt2 expression is more restricted, mainly in liver, muscle, brain, and white adipose tissue. It has been reported that hepatic ALT2 protein is approximately four times higher in male rats than in female rats.

References
  • Matthews, C.C. et al., 2002, Genomics. 79: 445-450.
  • Jadhao, S.B. et al., 2004, Hepatology. 39: 1297-1302.
  • Schindhelm, R.K. et al., 2005, Eur. J.Clin. Invest. 35:369-374.
  • Lindblom, P. et al., 2007, Arch Biochem Biophys. 466 (1): 66-77.
  • Liu, L.et al., 2008, Protein Expr Purif. 60 (2): 225-231.
  • Yang, R. Z. et al., 2009, Hepatology. 49 (2): 598-607.
  • Size / Price
    Catalog: RG80002-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"