After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat IL10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL10cDNA Clone Product Information
cDNA Size:537
cDNA Description:ORF Clone of Rattus norvegicus interleukin 10 DNA.
Gene Synonym:IL10X, Il10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

IL-10 Family & Receptor Related Products

IL-10 is a anti-inflammatory cytokine which belongs to the IL-10 family. It is produced by a variety of cell lines, including T-cells, macrophages, mast cells and other cell types, while it is produced primarily by monocytes and to a lesser extent by lymphocytes. IL-10 is mainly expressed in monocytes and Type 2 T helper cells (TH2), mast cells, CD4+CD25+Foxp3+ regulatory T cells, and also in a certain subset of activated T cells and B cells. IL-10 has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. IL-10 can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. The importance of interleukin 10 for counteracting excessive immunity in the human body is revealed by the fact that patients with Crohn's disease react favorably towards treatment with bacteria producing recombinant IL-10. IL-10 inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. It also displays a potent ability to suppress the antigen-presentation capacity of antigen presenting cells. However, it is also stimulatory towards certain T cells and mast cells and stimulates B cell maturation and antibody production.

  • Arimoto T, et al. (2007) Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 28(6):894-906.
  • Han X, et al. (2010) Effect of cobalt protoporphyrin on hyperexpression of heme oxygenase-1 and secretion of IL-10 in rat bone marrow mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 18(5):1297-301.
  • Cui QQ, et al. (2011) Expression of RhoA in the lung tissue of acute lung injury rats and the influence of RhoA on the expression of IL-8 and IL-10. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 77(7): 1436-41.