Quick Order

Rat CXCL7 / Ppbp ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PPBP cDNA Clone Product Information
NCBI RefSeq:NM_153721.1
RefSeq ORF Size:336bp
cDNA Description:Full length Clone DNA of Rattus norvegicus pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) with N terminal HA tag.
Gene Synonym:Cxcl7, Nap-2, Ppbp
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein (Nap-2). Nap-2 / PPBP / CXCL7 is released in large amounts from platelets following their activation and is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. Nap-2 / PPBP / CXCL7 has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. Nap-2 is a ligand for CXCR1 and CXCR2, and Nap-2, Nap-2 (73), Nap-2 (74), Nap-2 (1-66), and most potent Nap-2 (1-63) are chemoattractants and activators for neutrophils.

References
  • Walz A, et al. (1989) Effects of the neutrophil-activating peptide NAP-2, platelet basic protein, connective tissue-activating peptide III and platelet factor 4 on human neutrophils. J Exp Med. 170(5):1745-50.
  • Walz A, et al. (1990) Generation of the neutrophil-activating peptide NAP-2 from platelet basic protein or connective tissue-activating peptide III through monocyte proteases. J Exp Med. 171(2): 449-54.
  • Loetscher P, et al. (1994) Both interleukin-8 receptors independently mediate chemotaxis. Jurkat cells transfected with IL-8R1 or IL-8R2 migrate in response to IL-8, GRO alpha and NAP-2. FEBS Lett. 341(2-3): 187-92.
  • Size / Price
    Catalog: RG80066-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"