Quick Order

Rat CXCL2 / MIP-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL2cDNA Clone Product Information
Gene_bank_ref_id:NM_053647.1
cDNA Size:303
cDNA Description:ORF Clone of Rattus norvegicus chemokine (C-X-C motif) ligand 2 DNA.
Gene Synonym:Mip-2, Scyb2, Cxcl2
Species:Rat
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name
Background

Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MIP-2), Growth-regulated protein beta (Gro-beta) and Gro oncogene-2 (Gro-2), is a small cytokine belonging to the CXC chemokine family. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for CXCL2/MIP-2 or in the presence of a blocking Ab to CXCL2/MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for MIP-2 (as in CXCR2-deficient mice) or in the presence of a blocking Ab to MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. Understanding the regulation of lymphocyte traffic during tolerance induction may lead to novel therapies for autoimmunity, graft acceptance, and tumor rejection. Several studies have implicated the CXCL2 chemokine as a mediator in the development of sepsis. CXCL2/MIP-2 also plays a major role in mediating the neutrophilic inflammatory response of the rodent lung to particles such as quartz, crocidolite asbestos, as well as high doses of other relative innocuous dusts such as titanium dioxide.

References
  • Driscoll KE. (2000) TNFalpha and MIP-2: role in particle-induced inflammation and regulation by oxidative stress. Toxicol Lett. 112-113: 177-83.
  • Walpen S, et al. (2001) Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J. 15(3): 571-3.
  • Fahey TJ, et al. (1990) Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL-1. Cytokine. 2(2): 92-9.
  • Size / Price
    Catalog:RG80042-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"