After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CystatinC / CST3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST3cDNA Clone Product Information
cDNA Size:423
cDNA Description:ORF Clone of Rattus norvegicus cystatin C DNA.
Gene Synonym:CYSC, MGC105556, Cst3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in all nucleated cells, has been proposed as a replacement for serum creatinine for the assessment of renal function, particularly to detect small reductions in glomerular filtration rate. The mature, active form of human cystatin C is a single non-glycosylated polypeptide chain consisting of 120 amino acid residues, with a molecular mass of 13,343-13,359 Da, and containing four characteristic disulfide-paired cysteine residues. Cystatin C is a low-molecular-weight protein which has been proposed as a marker of renal function that could replace creatinine. Indeed, the concentration of Cystatin C is mainly determined by glomerular filtration and is particularly of interest in clinical settings where the relationship between creatinine production and muscle mass impairs the clinical performance of creatinine. Since the last decade, numerous studies have evaluated its potential use in measuring renal function in various populations. More recently, other potential developments for its clinical use have emerged. In almost all the clinical studies, Cystatin C demonstrated a better diagnostic accuracy than serum creatinine in discriminating normal from impaired kidney function, but controversial results have been obtained by comparing this protein with other indices of kidney disease, especially serum creatinine-based equations, such as early atherosclerosis, Alzheimer's dementia, vascular aneurysms, hyperhomocysteinaemia and other neurodegenerative diseases. Cystatin C could be a useful clinical tool to identify HIV-infected persons. In addition, its expression is up-regulated in malignance of certain tumor progression.

  • Mares J, et al. (2003) Use of cystatin C determination in clinical diagnostics. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 147(2): 177-80.
  • Mussap M, et al. (2004) Biochemistry and clinical role of human cystatin C. Crit Rev Clin Lab Sci. 41(5-6): 467-550.
  • Sronie-Vivien S, et al. (2008) Cystatin C: current position and future prospects. Clin Chem Lab Med. 46(12): 1664-86.
  • Taglieri N, et al. (2009) Cystatin C and cardiovascular risk. Clin Chem. 55(11): 1932-43.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items