Quick Order

Rat CD64 / FCGR1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat FCGR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001100836.1
RefSeq ORF Size:1062bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Fc fragment of IgG, high affinity Ia, receptor (CD64) with N terminal HA tag.
Gene Synonym:Fcgr1, Fcgr1b, FcgammaRI, Fcgr1a
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse high affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFNγ and G-CSF can induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.

Size / Price
Catalog: RG80016-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"