After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse GNB2L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GNB2L1cDNA Clone Product Information
cDNA Size:954
cDNA Description:ORF Clone of Mus musculus guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 DNA.
Gene Synonym:p205, Rack1, GB-like, AL033335, Gnb2-rs1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

RACK1 (guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1), also known as GNB2L1, contains 7 WD repeats and belongs to the WD repeat G protein beta family. In the liver, RACK1 is expressed at higher levels in activated hepatic stellate cells than in hepatocytes or Kupffer cells. It is up-regulated in hepatocellular carcinomas and in the adjacent non-tumor liver tissue. RACK1 is involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. It interacts with a wide variety of proteins and plays a role in many cellular processes. GNB2L1 binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. RACK1 may recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. It inhibits the activity of SRC kinases including SRC, LCK and YES1. RACK1 also inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. It enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer.

  • Jannot G, et al.. (2011) The ribosomal protein RACK1 is required for microRNA function in both C. elegans and humans. EMBO Rep. 12(6):581-6.
  • Wang F, et al. (2011) RACK1 regulates VEGF/Flt1-mediated cell migration via activation of a PI3K/Akt pathway. J Biol Chem. 286(11):9097-106.
  • Cao XX, et al. (2011) RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway. Breast Cancer Res Treat. 126(3):555-63.
  • Myklebust LM, et al. (2011) Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 21(11):1217-25.