Quick Order

Text Size:AAA

Mouse MAP1LC3B ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MAP1LC3B cDNA Clone Product Information
NCBI RefSeq:NM_026160.4
RefSeq ORF Size:378bp
cDNA Description:Full length Clone DNA of Mus musculus microtubule-associated protein 1 light chain 3 beta with C terminal HA tag.
Gene Synonym:Atg8; LC3b; Map1lc3; 1010001C15Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

References
  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • Size / Price
    Catalog: MG52515-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"