Quick Order

Text Size:AAA

Mouse AK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AK4cDNA Clone Product Information
cDNA Size:672
cDNA Description:ORF Clone of Mus musculus adenylate kinase 4 DNA.
Gene Synonym:Ak3, AK 4, Ak-3, Ak-4, Ak3l1, D4Ertd274e
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items