After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse GPT ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GPT cDNA Clone Product Information
Gene_bank_ref_id:NM_182805.2
RefSeq ORF Size:1491bp
cDNA Description:Full length Clone DNA of Mus musculus glutamic pyruvic transaminase, soluble with C terminal HA tag.
Gene Synonym:ALT; Gpt1; Gpt-1; 1300007J06Rik; 2310022B03Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (GPT), is a pyridoxal enzyme which belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family, Alanine aminotransferase subfamily. Gpt / Gpt1 / ALT catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. Gpt / Gpt1 / ALT is expressed in Liver, kidney, heart, and skeletal muscles and it expresses at moderate levels in the adipose tissue. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. GPT1/GPT is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis.

References
  • Bergmeyer HU, et al. (1978) Optimization of methods for aspartate aminotransferase and alanine aminotransferase. Clin Chem. 24(1): 58-73.
  • King MC, et al. (1980) Allele increasing susceptibility to human breast cancer may be linked to the glutamate-pyruvate transaminase locus. Science. 208(4442): 406-8.
  • Prati D, et al. (2002) Updated definitions of healthy ranges for serum alanine aminotransferase levels. Ann Intern Med. 137(1): 1-10.
  • Size / Price
    Catalog: MG52487-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"