Quick Order

Mouse CIB2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CIB2 cDNA Clone Product Information
Gene_bank_ref_id:BC005739.1
RefSeq ORF Size:564bp
cDNA Description:Full length Clone DNA of Mus musculus calcium and integrin binding family member 2 with N terminal HA tag.
Gene Synonym:AI449053, 2810434I23Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
References
  • Blazejczyk M, et al. (2006) Myristoylation and membranous localization of Calmyrin2, a new member of Neuronal Calcium-Sensor proteins. FENS Forum Abstracts. 3.
  • Hollenbach AD, et al. (2006) The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1574(3): 321-8.
  • Blazejczyk M, et al. (2009) Biochemical characterization and expression analysis of a novel EF-hand Ca2+ binding protein calmyrin2 (Cib2) in brain indicates its function in NMDA receptor mediated Ca2+ signaling. Archives of Biochemistry and Biophysics. 487(1): 66-78.
  • Size / Price
    Catalog: MG52594-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"