Quick Order

Text Size:AAA

Mouse CRIP2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CRIP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_024223.2
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Mus musculus cysteine rich protein 2 with C terminal HA tag.
Gene Synonym:Crp, Hlp, CRP2, CRP4, ESP1, C77570, AW743261, 0610010I23Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed in heart. CRIP2 contains two LIM zinc-binding domains. CRIP2 may participate in the differentiation of smooth muscle tissue. It also plays an important role in esophageal squamous cell carcinoma (ESCC) tumorigenesis. CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis. It interacts with the NF-κB/p65 to inhibit its DNA-binding ability to the promoter regions of the major proangiogenesis cytokines critical for tumor progression, including IL6, IL8, and VEGF. In conclusion, we provide compelling evidence that CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis.

References
  • Chang DF. et al., 2003, Dev Cell. 4 (1):107-18.
  • Huber A. et al., 2000, J Biol Chem. 275 (8): 5504-11.
  • Karim MA. et al., 1996, Genomics. 31 (2): 167-76.
  • Size / Price
    Catalog: MG52478-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"