Quick Order

Mouse PRKAR1A ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PRKAR1A cDNA Clone Product Information
Gene_bank_ref_id:NM_021880.2
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Mus musculus protein kinase, cAMP dependent regulatory, type I, alpha with N terminal HA tag.
Gene Synonym:Tse1, Tse-1, RIalpha, 1300018C22Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PRKAR1A, also known as PRKAR1 and PKR1, is one of the regulatory subunits of cAMP-dependent protein kinase A (PKA). PKA can be activated by cAMP. cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating PKA, which transduces the signal throughphosphorylation of different target proteins. The inactive holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits of PKA have been identified in humans. PRKAR1A was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids Three alternatively spliced transcript variants encoding the same protein have been observed.

References
  • Huang L J. et al., 1997, Proc Natl Acad Sci. 94 (21): 11184-9.
  • Herberg F W. et al., 2000, J Mol Biol. 298 (2): 329-39.
  • Scambler P. et al., 1987, Am J Hum Genet. 41 (5): 925-32.
  • Size / Price
    Catalog: MG51743-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"