Quick Order

Text Size:AAA

Mouse CFL2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CFL2 cDNA Clone Product Information
NCBI RefSeq:NM_007688.2
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Mus musculus cofilin 2, muscle with N terminal HA tag.
Gene Synonym:Cfl2
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein superfamily. Cofilin2 shows significant homology to the other two members: cofilin 1 and DSTN, through its entire sequence, and contains residues conserved among the cofilin family that are responsible for actin-binding. Cofilin 2 (CFL2) is an important regulator of striated myocyte function. Purified cofilin 2 depolymerized actin filaments in a dose- and pH-dependent manner and reduced the apparent viscosity of an actin solution, although they did not co-sediment with actin filaments at all. Cofilin2 is not expressed in vegetative cells, but is transiently induced during the aggregation stage of development, whereas cofilin 1 was predominantly expressed in vegetative cells. 

References
  • Aizawa H, et al. (2001) Cofilin-2, a novel type of cofilin, is expressed specifically at aggregation stage of Dictyostelium discoideum development. Genes Cells. 6 (10): 913-21.
  • Papalouka V, et al. (2009) Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Papalouka V, Mol Cell Biol. 29 (22): 6046-58.
  • Size / Price
    Catalog: MG51672-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"