After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse RBBP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RBBP4cDNA Clone Product Information
cDNA Size:1278
cDNA Description:ORF Clone of Mus musculus retinoblastoma binding protein 4 DNA.
Gene Synonym:mRbAp48
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Histone-binding protein RBBP4, also known as Retinoblastoma-binding protein 4, Retinoblastoma-binding protein p48, Chromatin assembly factor 1 subunit C, Chromatin assembly factor I p48 subunit, Nucleosome-remodeling factor subunit RBAP48 and RBBP4, is a nucleus protein which belongs to the WD repeat RBAP46/RBAP48/MSI1 family. RBBP4 is a core histone-binding subunit that may target chromatin assembly factors, chromatin remodeling factors and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. RBBP4 is a component of several complexes which regulate chromatin metabolism. These include the chromatin assembly factor 1 (CAF-1) complex, which is required for chromatin assembly following DNA replication and DNA repair; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling and the NURF (nucleosome remodeling factor) complex.

One common myth is that age-related memory loss is an early indication of Alzheimer's disease. But researchers at the Columbia University Medical Center in New York City have found a specific protein, RbAp48, that they believe is responsible for age-related memory problems. What's more, by replenishing RbAp48 in the brains of mice, the researchers were able to undo existing age-related memory damage.

To find RbAp48, researchers focused on the hippocampus, the region of the brain where memories are formed. After studying eight healthy brains donated to science by people between the ages of 33 and 88, they found that RbAp48 was reduced by nearly 50 percent in the older brains. The researchers found that when they turned off RbAp48 in younger mice, they became more forgetful, while increasing RbAp48 in older mice restored memory. The mice were given memory tests that included object recognition and water maze problems.

  • Rasmussen HH. et al.,1992, Electrophoresis 13:960-9.
  • Qian Y.-W. et al., 1993,  Nature 364:648-52.
  • Yarden R.I. et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 4983-8.
  • Ota T. et al., 2004, Nat. Genet. 36:40-45.
  • Gauci S. et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items