After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse VAMP3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VAMP3 cDNA Clone Product Information
Gene_bank_ref_id:NM_009498.4
RefSeq ORF Size:312bp
cDNA Description:Full length Clone DNA of Mus musculus vesicle-associated membrane protein 3 with N terminal HA tag.
Gene Synonym:ceb, VAMP-3, D130027G05Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

VAMP3, also known as cellubrevin, is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. Because of VAMP3 gene's high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, VAMP3 was shown to be the human equivalent of the rodent cellubrevin. In platelets VAMP3 resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation.

References
  • Bernstein AM. et al., 1999, Blood. 93 (2): 571-9.
  • Annaert WG. et al., 1997, J Cell Biol. 139 (6): 1397-410.
  • Hager HA. et al., 2010, EMBO J. 29 (3): 532-45.
  • Size / Price
    Catalog: MG51490-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"