Quick Order

Mouse MAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAGcDNA Clone Product Information
cDNA Size:1749
cDNA Description:ORF Clone of Mus musculus myelin-associated glycoprotein DNA.
Gene Synonym:Gma, siglec-4a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

The myelin-associated glycoprotein (MAG) contains five immunoglobulin-like domains and belongs to the sialic-acid-binding subgroup of the Ig superfamily. MAG is a transmembrane glycoprotein of 100kDa localized in myelin sheaths of periaxonal Schwann cell and oligodendroglial membranes where it functions in glia-axon interactions. It appears to function both as a receptor for an axonal signal that promotes the differentiation, maintenance and survival of oligodendrocytes and as a ligand for an axonal receptor that is needed for the maintence of myelinated axons. MAG contains a carbohydrate epitope shared with other glycoconjugates that is a target antigen in autoimmune peripheral neuropathy associated with IgM gammopathy and has been implicated in a dying back oligodendrogliopathy in multiple sclerosis. MAG is considered as a transmembrane protein of both CNS and PNS myelin and it strongly inhibits neurite outgrowth in both developing cerebellar and adult dosal root ganglion neurons. In contrast, MAG promotes neurite outgrowth from newborn DRG neurons. Thus, MAG may be responsible for the lack of CNS nerve regeneration and may influce both temporally and spatially regeneration in the PNS.

  • Quarles RH. (2007) Myelin-associated glycoprotein (MAG): past, present and beyond. J Neurochem. 100(6):1431-48.
  • Mukhopadhyay G, et al. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 13(3): 757-67.
  • Barton DE, et al. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-12.