Quick Order

Mouse TSC22D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TSC22D1cDNA Clone Product Information
cDNA Size:432
cDNA Description:ORF Clone of Mus musculus TSC22 domain family, member 1 DNA.
Gene Synonym:Tsc, Egr5, Tsc22, TSC-22, Tgfb1i4, AA589566, AW105905
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse TSC22D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items