Quick Order

Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRCcDNA Clone Product Information
cDNA Size:1626
cDNA Description:ORF Clone of Mus musculus Rous sarcoma oncogene transcript variant 1 DNA.
Gene Synonym:AW259666, pp60c-src, Src
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG51118-ACG$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG51118-ACR$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG51118-ANG$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG51118-ANR$345
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG51118-CF$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG51118-CH$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG51118-CM$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG51118-CY$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone)MG51118-G$195
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedMG51118-G-F$395
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG51118-NF$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG51118-NH$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG51118-NM$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG51118-NY$315
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG51118-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.