After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse CNTN5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNTN5cDNA Clone Product Information
cDNA Size:2682
cDNA Description:ORF Clone of Mus musculus contactin 5 DNA.
Gene Synonym:NB-2, Gm507, 6720426O10Rik, A830025P08Rik, Cntn5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed mainly in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-5, also known as NB-2, is one of the neural recognition molecules in the contactin subgroup. Contactin-5 is expressed in brain and kidney and at very low level in placenta. In brain, Contactin-5 is highly expressed in the occipital lobe, amygdala, cerebral cortex, frontal lobe, thalamus and temporal lobe. Mice deficient in the Contactin-5 gene exhibit aberrant responses to acoustic stimuli. Contactin-5 may play a role in maturation of glutamatergic synapses in the brainstem during the final stages of auditory development. Contactin-5 gene may contribute to human neurological disorders.

  • Kamei Y, et al. (2000) Human NB-2 of the contactin subgroup molecules: chromosomal localization of the gene (CNTN5) and distinct expression pattern from other subgroup members. Genomics 69(1):113-9.
  • Ogawa J, et al. (2001) Neural recognition molecule NB-2 of the contactin/F3 subgroup in rat: Specificity in neurite outgrowth-promoting activity and restricted expression in the brain regions. J Neurosci Res. 65(2):100-10.
  • Li H, et al. (2003) Aberrant responses to acoustic stimuli in mice deficient for neural recognition molecule NB-2. Eur J Neurosci. 17(5):929-36.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Toyoshima M, et al. (2009) Preferential localization of neural cell recognition molecule NB-2 in developing glutamatergic neurons in the rat auditory brainstem. J Comp Neurol. 513(4):349-62.