Quick Order

Text Size:AAA

Mouse OPCML Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OPCMLcDNA Clone Product Information
cDNA Size:1014
cDNA Description:ORF Clone of Mus musculus opioid binding protein/cell adhesion molecule-like DNA.
Gene Synonym:Gm181, Obcam, AI844366, MGC99974, 3732419F12, C230027C17, 2900075O15Rik, B930023M13Rik, Opcml
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items