Quick Order

Mouse FLT1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FLT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_010228.3
RefSeq ORF Size:4002bp
cDNA Description:Full length Clone DNA of Mus musculus FMS-like tyrosine kinase 1 with N terminal HA tag.
Gene Synonym:Flt-1, sFlt1, VEGFR1, VEGFR-1, AI323757, Flt
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGF-B / VEGFB Protein (Fc Tag)Mouse VEGFA / VEGF164 ProteinHuman VEGF121 / VEGF-A ProteinMouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Mouse PIGF / PLGF Protein (Fc Tag)Rat VEGF164 / VEGFA ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGF121 / VEGF-A ProteinMouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinDanio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinMouse VEGF-D / VEGFD / FIGF Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Mouse PIGF / PLGF ProteinHuman VEGF121b / VEGF-A ProteinCanine VEGF / VEGFA ProteinHuman Neuropilin 2 / NRP2 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein
Background

Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein kinase receptor FLT, Vascular permeability factor receptor and FLT1, is a single-pass type I membrane protein and secreted protein which belongs to the protein kinase superfamily, Tyr protein kinase family and CSF-1/PDGF receptor subfamily. VEGFR-1 / FLT1 contains seven Ig-like C2-type (immunoglobulin-like) domains and one protein kinase domain. VEGFR-1 / FLT1 is expressed mostly in normal lung, but also in placenta, liver, kidney, heart and brain tissues. It is specifically expressed in most of the vascular endothelial cells, and also expressed in peripheral blood monocytes. VEGFR-1 / FLT1 is not expressed in tumor cell lines. VEGFR-1 / FLT1 is an essential receptor tyrosine kinase that regulates mammalian vascular development and embryogenesis. EGF-induced angiogenesis requires inverse regulation of VEGFR-1 and VEGFR-2 in tumor-associated endothelial cells. VEGFR-1 / FLT1 is a receptor for VEGF, VEGFB and PGF. It has a tyrosine-protein kinase activity. The VEGF-kinase ligand/receptor signaling system plays a key role in vascular development and regulation of vascular permeability.

Size / Price
Catalog: MG51045-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"