Quick Order

Mouse AKT3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AKT3cDNA Clone Product Information
cDNA Size:1440
cDNA Description:ORF Clone of Mus musculus thymoma viral proto-oncogene 3 DNA.
Gene Synonym:AI851531, D930002M15Rik, Akt3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.

  • Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.
  • Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.
  • Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.
  • Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.
  • Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.
  • Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items