Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV WNV-C cDNA Clone Product Information
NCBI RefSeq:DQ211652.1
RefSeq ORF Size:315bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C with C terminal His tag.
Gene Synonym:WNV-C
Species:WNV
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (97..411), corresponding to amino acid sequence YP_001527878.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tag on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-GFPSpark tagVG40344-ACG$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40344-ACR$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-GFPSpark tagVG40344-ANG$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40344-ANR$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40344-CF$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tagVG40344-CH$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-Myc tagVG40344-CM$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA tagVG40344-CY$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid (Codon Optimized)VG40344-G$95
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Flag tagVG40344-NF$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-His tagVG40344-NH$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Myc tagVG40344-NM$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-HA tagVG40344-NY$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C natural ORF mammalian expression plasmidVG40344-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40344-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"