After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SFTSV SFTSV-NSs cDNA Clone Product Information
Gene_bank_ref_id:KC505125.1
RefSeq ORF Size:882bp
cDNA Description:Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs with C terminal His tag.
Gene Synonym:SFTSV-NSs
Species:SFTSV
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-His tag on other vectors
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-GFPSpark tagVG40343-ACG$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40343-ACR$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-GFPSpark tagVG40343-ANG$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40343-ANR$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40343-CF$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-His tagVG40343-CH$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-Myc tagVG40343-CM$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-HA tagVG40343-CY$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid (Codon Optimized)VG40343-G$95
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-Flag tagVG40343-NF$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-His tagVG40343-NH$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-Myc tagVG40343-NM$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-HA tagVG40343-NY$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs natural ORF mammalian expression plasmidVG40343-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40343-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"