Quick Order

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SFTSV SFTSV-N cDNA Clone Product Information
Gene_bank_ref_id:KC505125.1
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N with C terminal His tag.
Gene Synonym:SFTSV-N
Species:SFTSV
Vector:pCMV3-C-His
Plasmid:pCMV3-AGP25448-N-His
Restriction Site:KpnI + XbaI (6kb + 0.79kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-His tag on other vectors
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-GFPSpark tagVG40342-ACG$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40342-ACR$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, N-GFPSpark tagVG40342-ANG$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40342-ANR$325
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40342-CF$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-His tagVG40342-CH$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-Myc tagVG40342-CM$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, C-HA tagVG40342-CY$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid (Codon Optimized)VG40342-G$95
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, N-Flag tagVG40342-NF$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, N-His tagVG40342-NH$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, N-Myc tagVG40342-NM$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N ORF mammalian expression plasmid, N-HA tagVG40342-NY$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) N natural ORF mammalian expression plasmidVG40342-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40342-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"