After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
 PRRSV-N cDNA Clone Product Information
Gene_bank_ref_id:U87392.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N with C terminal His tag.
Gene Synonym:PRRSV-N
Species:PRRSV
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-His tag on other vectors
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40337-ACG$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40337-ACR$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40337-ANG$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40337-ANR$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40337-CF$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-His tagVG40337-CH$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-Myc tagVG40337-CM$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-HA tagVG40337-CY$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid (Codon Optimized)VG40337-G$95
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-Flag tagVG40337-NF$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-His tagVG40337-NH$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-Myc tagVG40337-NM$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-HA tagVG40337-NY$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmidVG40337-UT$295
 Learn more about expression Vectors
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"