Quick Order

Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DENV DENV-NS4A cDNA Clone Product Information
Gene_bank_ref_id:AF038403.1
RefSeq ORF Size:381bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4A with C terminal His tag.
Gene Synonym:DENV-NS4A
Species:DENV
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6376..6756), corresponding to amino acid sequence AAC59275.1 (aa 2094-2220).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-His tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-GFPSpark tagVG40265-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40265-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-GFPSpark tagVG40265-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40265-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-Flag tagVG40265-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-His tagVG40265-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-Myc tagVG40265-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA tagVG40265-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid (Codon Optimized)VG40265-G$95
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-Flag tagVG40265-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-His tagVG40265-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-Myc tagVG40265-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-HA tagVG40265-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS4A natural ORF mammalian expression plasmidVG40265-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40265-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"