Quick Order

HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIV-envcDNA Clone Product Information
Gene_bank_ref_id:GQ324962.1
cDNA Size:2577
cDNA Description:ORF Clone of HIV-1 (group N, strain 06CM-U14297) env DNA.
Gene Synonym:HIV-env
Species:HIV
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40255-ACG$425
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40255-ACR$425
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40255-CF$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40255-CH$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40255-CM$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40255-CY$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone)VG40255-G$295
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40255-NF$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40255-NH$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40255-NM$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40255-NY$395
HIV-1 (group N, strain 06CM-U14297) env Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40255-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40255-CH
List Price: $395.00  (Save $0.00)
Price:$395.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"