Quick Order

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIV HIV-gag cDNA Clone Product Information
Gene_bank_ref_id:U51190.1
RefSeq ORF Size:1500bp
cDNA Description:Full length Clone DNA of HIV-1 (group M, subtype A, strain 92UG037.1) gag with C terminal His tag.
Gene Synonym:HIV-gag
Species:HIV
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-His tag on other vectors
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40241-ACG$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40241-ACR$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40241-ANG$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40241-ANR$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Flag tagVG40241-CF$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-His tagVG40241-CH$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Myc tagVG40241-CM$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-HA tagVG40241-CY$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid (Codon Optimized)VG40241-G$195
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Flag tagVG40241-NF$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His tagVG40241-NH$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Myc tagVG40241-NM$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-HA tagVG40241-NY$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag natural ORF mammalian expression plasmidVG40241-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40241-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"