After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged, expression ready

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1701
cDNA Description:ORF Clone of Influenza A H5N1 (A/Xinjiang/1/2006) HA DNA.
Gene Synonym:HA1, Hemagglutinin
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged, expression ready on other vectors
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG40004-ACG$345
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG40004-ACR$345
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression readyVG40004-C$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged, expression readyVG40004-CF$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged, expression readyVG40004-CH$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged, expression readyVG40004-CM$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged, expression readyVG40004-CY$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged, expression readyVG40004-NF$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged, expression readyVG40004-NH$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged, expression readyVG40004-NM$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged, expression readyVG40004-NY$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged, expression readyVG40004-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name