Quick Order

Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1701
cDNA Description:ORF Clone of Influenza A H3N2 (A/Wisconsin/67/X-161/2005) HA DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:HA1, Hemagglutinin
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-tagged on other vectors
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG11972-ACG$345
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG11972-ACR$345
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG11972-C$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG11972-CF$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG11972-CH$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG11972-CM$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG11972-CY$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG11972-NF$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG11972-NH$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG11972-NM$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG11972-NY$315
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG11972-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items