Quick Order

Human cytomegalovirus (HCMV) gB ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CMV GB cDNA Clone Product Information
Gene_bank_ref_id:AY315197.2
RefSeq ORF Size:2724bp
cDNA Description:Full length Clone DNA of Homo cytomegalovirus gB with C terminal His tag.
Gene Synonym:gB
Species:CMV
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Human cytomegalovirus (CMV) (human herpesvirus 5) glycoprotein B, also referred as CMV gB or gB, which belongs to the herpesviridae glycoprotein B family. It is a 907-amino acid glycoprotein encoded by the ORF of UL55. Cytomegalovirus Glycoprotein B protein is the most abundant component of the envelope, a target of neutralizing antibodies with at least two defined neutralizing epitopes and an essential replication component. Cytomegalovirus Glycoprotein B protein plays important roles in HCMV entry, cell-cell spread of internal virions, and fusion of infected cells. In addition, Cytomegalovirus Glycoprotein B protein is one envelope protein capable of heparin binding. It forms a physical association with host cell annexin II independent of the presence of calcium.

References
  • Lopper M,et al. (2002). Disulfide bond configuration of human cytomegalovirus glycoprotein B. J Virol. 76(12): 6073-82.
  • Isaacson MK, et al. (2009) Human cytomegalovirus glycoprotein B is required for virus entry and cell-to-cell spread but not for virion attachment, assembly, or egress. J Virol. 83(8): 3891-903.
  •  

     
    Size / Price
    Catalog: VG10202-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"