Quick Order

Text Size:AAA

Mouse DPP7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DPP7cDNA Clone Product Information
Gene_bank_ref_id:NM_031843.2
cDNA Size:1521
cDNA Description:ORF Clone of Mus musculus dipeptidylpeptidase 7 DNA.
Gene Synonym:QPP, Dpp2, DPPII, Dpp7
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

References
  • Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.
  • Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.
  • Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.
  • Size / Price
    Catalog:MG51019-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"