Quick Order

Rat IL21R Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL21RcDNA Clone Product Information
cDNA Size:1566
cDNA Description:ORF Clone of Rattus norvegicus interleukin 21 receptor DNA.
Gene Synonym:MGC108921, Il21r
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Other Interleukin & Receptor Related Products
Product nameProduct name
Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Human IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinHuman IL5Ra / CD125 Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinHuman IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-3 / Interleukin-3 Protein (His Tag)Mouse IL-4R / CD124 Protein (ECD, His Tag)Mouse IL4 / Interleukin-4 ProteinMouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL2RA / CD25 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinCanine IL13RA2 / IL13R Protein (His Tag)Human IL5 / Interleukin 5 ProteinRat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL16 / Interleukin-16 Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)

Interleukin-21 receptor, also known as IL-21 receptor, IL-21R, Novel interleukin receptor, IL21R and NILR, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 4 subfamily. Interleukin-21 (IL-21) belongs to a family of cytokines that bind to a composite receptor consisting of a private receptor (IL-21R) and the common cytokine receptor gamma chain ( gamma(C) ). The IL-21R is discovered as a novel member of the class-I-cytokine-receptor family and is selectively expressed in lymphoid tissues. IL-21R shows strong sequence homologies to the interleukin-4 receptor alpha chain gene (IL-4RA). The WSXWS motif of IL-21R appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif of IL-21R is required for JAK interaction and / or activation. The IL-21R is widely distributed on lympho-haematopoietic cells and IL21 impacts a number of cell types, including CD8+ memory T cells, NK cells and subsets of CD4 memory T cells. Increased IL21 production is characteristic of certain autoimmune diseases and is likely to contribute to autoantibody production as well as pathological features of autoimmune disease. The critical role of IL21 in promoting humoral immune responses makes it an important focus of potential therapeutic interventions in conditions characterised by overproduction of pathogenic autoantibodies.

  • Asao H, et al. (2001) Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol. 167(1): 1-5.
  • Wu Z, et al. (2005) Interleukin-21 receptor gene induction in human T cells is mediated by T-cell receptor-induced Sp1 activity. Mol Cell Biol. 25(22): 9741-52.
  • De Totero D, et al. (2006) Interleukin-21 receptor (IL-21R) is up-regulated by CD40 triggering and mediates proapoptotic signals in chronic lymphocytic leukemia B cells. Blood. 107(9): 3708-15.

    Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items