After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CPM Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPMcDNA Clone Product Information
Gene_bank_ref_id:NM_027468.1
cDNA Size:1332
cDNA Description:ORF Clone of Mus musculus carboxypeptidase M DNA.
Gene Synonym:AA589379, MGC118152, 1110060I01Rik, 5730456K23Rik, E030045M14Rik, Cpm
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.

References
  • Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.
  • Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.
  • Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.
  • Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.
  • Size / Price
    Catalog:MG50990-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"