Quick Order

Mouse KLK-8 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse KLK8 cDNA Clone Product Information
Gene_bank_ref_id:NM_008940.2
RefSeq ORF Size:783bp
cDNA Description:Full length Clone DNA of Mus musculus kallikrein related-peptidase 8 with N terminal HA tag.
Gene Synonym:BSP1, Nrpn, Prss19, Klk8
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Kallikrein-8, also known as Neuropsin, Serine protease 19, Serine protease TADG-14, Tumor-associated differentially expressed gene 14 protein and KLK8, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. It is a serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Kallikrein-8 / KLK8 plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway. It regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. It is involved in skin desquamation and keratinocyte proliferation and plays a role in the secondary phase of pathogenesis following spinal cord injury. It also cleaves L1CAM in response to increased neural activity. It induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Kallikrein-8 / KLK8 is expressed at high levels in serum, ascites fluid and tumor cytosol of advanced stage ovarian cancer patients and may serve as a marker of ovarian cancer. Kallikrein-8 / KLK8 may have potential clinical value for disease diagnosis or prognosis and it may also be a useful therapeutic target.

Size / Price
Catalog: MG50967-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"