After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse BCAM Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCAMcDNA Clone Product Information
cDNA Size:1869
cDNA Description:ORF Clone of Mus musculus basal cell adhesion molecule DNA.
Gene Synonym:Lu, Gplu, B-CAM, 1200005K12Rik, Bcam
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2 glycoprotein isoforms of the immunoglobulin superfamily representing receptors for the laminin alpha(5) chain. It is a transmembrane receptor with five immunoglobulin-like domains in its extracellular region, and is therefore classified as a member of the immunoglobulin (Ig) gene family. In addition to red blood cells, Lu/BCAM proteins are expressed in endothelial cells of vascular capillaries and in epithelial cells of several tissues. BCAM/LU has a wide tissue distribution with a predominant expression in the basal layer of the epithelium and the endothelium of blood vessel walls. As designated as CD239 recently, BCAM and LU share a significant sequence similarity with the CD146 (MUC18) and CD166, and themselves are adhesion molecules that bind laminin with high affinity. Laminins are found in all basement membranes and are involved in cell differentiation, adhesion, migration, and proliferation. BCAM is upregulated following malignant transformation of some cell types in vivo and in vitro, thus being a candidate molecule involved in tumor progression. In addition, BCAM interacts with integrin in sickle red cells, and thus may potentially play a role in vaso-occlusive episodes.

  • Kikkawa Y, et al. (2005) Review: Lutheran/B-CAM: a laminin receptor on red blood cells and in various tissues. Connect Tissue Res. 46 (4-5): 193-9.
  • El Nemer W, et al. (2007) Endothelial Lu/BCAM glycoproteins are novel ligands for red blood cell alpha4beta1 integrin: role in adhesion of sickle red blood cells to endothelial cells. Blood. 109 (8): 3544-51.
  • Colin Y, et al. (2008) Red cell and endothelial Lu/BCAM beyond sickle cell disease. Transfus Clin Biol. 15 (6): 402-5.
  • El Nemer W, et al. (2008) Role of Lu/BCAM in abnormal adhesion of sickle red blood cells to vascular endothelium. Transfus Clin Biol. 15 (1-2): 29-33.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items